Misc

.eslintrc.js

@@ -0,0 +1,79 @@
+/** @type {import("eslint").Linter.Config} */
+module.exports = {
+  parser: '@typescript-eslint/parser',
+  plugins: ['prettier', '@typescript-eslint'],
+  extends: [
+    'eslint:recommended',
+    'plugin:@typescript-eslint/recommended',
+    'plugin:@typescript-eslint/recommended-type-checked',
+    'plugin:@typescript-eslint/stylistic-type-checked',
+    'plugin:prettier/recommended',
+    'plugin:unicorn/recommended',
+  ],
+  parser: '@typescript-eslint/parser',
+  parserOptions: {
+    tsconfigRootDir: __dirname,
+    project: './tsconfig.lint.json',
+  },
+  rules: {
+    '@typescript-eslint/no-unused-vars': [
+      'warn',
+      { argsIgnorePattern: '^_', ignoreRestSiblings: true },
+    ],
+    'no-underscore-dangle': 0,
+    curly: 'error',
+    '@typescript-eslint/no-explicit-any': 0,
+    '@typescript-eslint/explicit-module-boundary-types': 0,
+    '@typescript-eslint/ban-ts-comment': 0,
+    semi: ['error', 'never'],
+    'unicorn/no-new-array': 'off',
+    'unicorn/no-empty-file': 'off',
+    'unicorn/prefer-type-error': 'off',
+    'unicorn/prefer-modern-math-apis': 'off',
+    'unicorn/prefer-node-protocol': 'off',
+    'unicorn/no-unreadable-array-destructuring': 'off',
+    'unicorn/no-abusive-eslint-disable': 'off',
+    'unicorn/no-array-callback-reference': 'off',
+    'unicorn/number-literal-case': 'off',
+    'unicorn/prefer-add-event-listener': 'off',
+    'unicorn/prefer-top-level-await': 'off',
+    'unicorn/consistent-function-scoping': 'off',
+    'unicorn/no-await-expression-member': 'off',
+    'unicorn/no-lonely-if': 'off',
+    'unicorn/consistent-destructuring': 'off',
+    'unicorn/prefer-module': 'off',
+    'unicorn/prefer-optional-catch-binding': 'off',
+    'unicorn/no-useless-undefined': 'off',
+    'unicorn/no-null': 'off',
+    'unicorn/no-nested-ternary': 'off',
+    'unicorn/filename-case': 'off',
+    'unicorn/catch-error-name': 'off',
+    'unicorn/prevent-abbreviations': 'off',
+    'unicorn/prefer-code-point': 'off',
+    'unicorn/numeric-separators-style': 'off',
+    'unicorn/no-array-for-each': 'off',
+    'unicorn/prefer-spread': 'off',
+    'unicorn/explicit-length-check': 'off',
+    'unicorn/prefer-regexp-test': 'off',
+    'unicorn/relative-url-style': 'off',
+    'unicorn/prefer-math-trunc': 'off',
+    'unicorn/prefer-query-selector': 'off',
+    'unicorn/no-negated-condition': 'off',
+    'unicorn/switch-case-braces': 'off',
+    'unicorn/prefer-switch': 'off',
+    'unicorn/better-regex': 'off',
+    'unicorn/no-for-loop': 'off',
+    'unicorn/escape-case': 'off',
+    'unicorn/prefer-number-properties': 'off',
+    'unicorn/no-process-exit': 'off',
+
+    '@typescript-eslint/no-unsafe-member-access': 'off',
+    '@typescript-eslint/no-unsafe-argument': 'off',
+    '@typescript-eslint/no-unsafe-assignment': 'off',
+    '@typescript-eslint/no-unsafe-call': 'off',
+    '@typescript-eslint/no-unsafe-return': 'off',
+    '@typescript-eslint/prefer-nullish-coalescing': 'off',
+    '@typescript-eslint/restrict-template-expressions': 'off',
+    '@typescript-eslint/require-await': 'off',
+  },
+}

package.json

@@ -50,20 +50,20 @@
     "@types/buffer-crc32": "^0.2.4",
     "@types/jest": "^29.5.11",
     "@types/long": "^4.0.0",
-    "@types/node": "^20.10.4",
-    "@typescript-eslint/eslint-plugin": "^6.13.2",
-    "@typescript-eslint/parser": "^6.13.2",
-    "eslint": "^8.55.0",
+    "@types/node": "^20.11.5",
+    "@typescript-eslint/eslint-plugin": "^6.19.1",
+    "@typescript-eslint/parser": "^6.19.1",
+    "eslint": "^8.56.0",
     "eslint-config-prettier": "^9.1.0",
-    "eslint-plugin-import": "^2.29.0",
-    "eslint-plugin-prettier": "^5.0.1",
-    "eslint-plugin-unicorn": "^49.0.0",
+    "eslint-plugin-import": "^2.29.1",
+    "eslint-plugin-prettier": "^5.1.3",
+    "eslint-plugin-unicorn": "^50.0.1",
     "jest": "^29.7.0",
     "jest-fetch-mock": "^3.0.3",
-    "prettier": "^3.1.1",
+    "prettier": "^3.2.4",
     "rimraf": "^5.0.5",
     "standard-changelog": "^5.0.0",
-    "ts-jest": "^29.1.1",
+    "ts-jest": "^29.1.2",
     "typescript": "^5.3.3"
   },
   "publishConfig": {

src/bai.ts

@@ -50,7 +50,7 @@ export default class BAI extends IndexFile {
     let curr = 8
     let firstDataLine: VirtualOffset | undefined
 
-    type BinIndex = { [key: string]: Chunk[] }
+    type BinIndex = Record<string, Chunk[]>
     type LinearIndex = VirtualOffset[]
     const indices = new Array<{
       binIndex: BinIndex
@@ -63,7 +63,7 @@ export default class BAI extends IndexFile {
       let stats
 
       curr += 4
-      const binIndex: { [key: number]: Chunk[] } = {}
+      const binIndex: Record<number, Chunk[]> = {}
 
       for (let j = 0; j < binCount; j += 1) {
         const bin = bytes.readUInt32LE(curr)
@@ -137,7 +137,7 @@ export default class BAI extends IndexFile {
     const depths = range
       ? new Array((e - s) / v)
       : new Array(linearIndex.length - 1)
-    const totalSize = linearIndex[linearIndex.length - 1].blockPosition
+    const totalSize = linearIndex.at(-1).blockPosition
     if (e > (linearIndex.length - 1) * v) {
       throw new Error('query outside of range of linear index')
     }

src/bamFile.ts

@@ -17,10 +17,6 @@ export const BAM_MAGIC = 21840194
 
 const blockLen = 1 << 16
 
-function isGzip(buf: Buffer) {
-  return buf[0] === 31 && buf[1] === 139 && buf[2] === 8
-}
-
 async function gen2array<T>(gen: AsyncIterable<T[]>): Promise<T[]> {
   let out: T[] = []
   for await (const x of gen) {
@@ -158,10 +154,10 @@ export default class BamFile {
       }
       buffer = res.buffer.subarray(0, Math.min(res.bytesRead, ret))
     } else {
-      buffer = (await this.bam.readFile(opts)) as Buffer
+      buffer = await this.bam.readFile(opts)
     }
 
-    const uncba = isGzip(buffer) ? await unzip(buffer) : buffer
+    const uncba = await unzip(buffer)
 
     if (uncba.readInt32LE(0) !== BAM_MAGIC) {
       throw new Error('Not a BAM file')
@@ -202,7 +198,7 @@ export default class BamFile {
     refSeqBytes: number,
     opts?: BaseOpts,
   ): Promise<{
-    chrToIndex: { [key: string]: number }
+    chrToIndex: Record<string, number>
     indexToChr: { refName: string; length: number }[]
   }> {
     if (start > refSeqBytes) {
@@ -220,10 +216,10 @@ export default class BamFile {
       throw new Error('Error reading refseqs from header')
     }
     const ret = buffer.subarray(0, Math.min(bytesRead, refSeqBytes))
-    const uncba = isGzip(ret) ? await unzip(ret) : ret
+    const uncba = await unzip(ret)
     const nRef = uncba.readInt32LE(start)
     let p = start + 4
-    const chrToIndex: { [key: string]: number } = {}
+    const chrToIndex: Record<string, number> = {}
     const indexToChr: { refName: string; length: number }[] = []
     for (let i = 0; i < nRef; i += 1) {
       const lName = uncba.readInt32LE(p)
@@ -317,10 +313,10 @@ export default class BamFile {
 
   async fetchPairs(chrId: number, feats: BAMFeature[][], opts: BamOpts) {
     const { pairAcrossChr, maxInsertSize = 200000 } = opts
-    const unmatedPairs: { [key: string]: boolean } = {}
-    const readIds: { [key: string]: number } = {}
+    const unmatedPairs: Record<string, boolean> = {}
+    const readIds: Record<string, number> = {}
     feats.map(ret => {
-      const readNames: { [key: string]: number } = {}
+      const readNames: Record<string, number> = {}
       for (const element of ret) {
         const name = element.name()
         const id = element.id()
@@ -408,21 +404,12 @@ export default class BamFile {
       chunk.fetchedSize(),
       opts,
     )
-    if (isGzip(buffer)) {
-      const {
-        buffer: data,
-        cpositions,
-        dpositions,
-      } = await unzipChunkSlice(buffer, chunk)
-      return { data, cpositions, dpositions, chunk }
-    } else {
-      // const {
-      //   buffer,
-      //   cpositions: [],
-      //   dpositions: [],
-      console.log(buffer)
-      return { data: buffer, cpositions: [], dpositions: [], chunk }
-    }
+    const {
+      buffer: data,
+      cpositions,
+      dpositions,
+    } = await unzipChunkSlice(buffer, chunk)
+    return { data, cpositions, dpositions, chunk }
   }
 
   async readBamFeatures(
@@ -442,6 +429,7 @@ export default class BamFile {
 
       // increment position to the current decompressed status
       if (dpositions) {
+        // eslint-disable-next-line no-empty
         while (blockStart + chunk.minv.dataPosition >= dpositions[pos++]) {}
         pos--
       }

src/csi.ts

@@ -42,9 +42,7 @@ export default class CSI extends IndexFile {
     const coordinateType =
       formatFlags & 0x10000 ? 'zero-based-half-open' : '1-based-closed'
     const format = (
-      { 0: 'generic', 1: 'SAM', 2: 'VCF' } as {
-        [key: number]: string
-      }
+      { 0: 'generic', 1: 'SAM', 2: 'VCF' } as Record<number, string>
     )[formatFlags & 0xf]
     if (!format) {
       throw new Error(`invalid Tabix preset format flags ${formatFlags}`)
@@ -97,7 +95,7 @@ export default class CSI extends IndexFile {
     const aux = auxLength >= 30 ? this.parseAuxData(bytes, 16) : undefined
     const refCount = bytes.readInt32LE(16 + auxLength)
 
-    type BinIndex = { [key: string]: Chunk[] }
+    type BinIndex = Record<string, Chunk[]>
 
     // read the indexes for each reference sequence
     let curr = 16 + auxLength + 4
@@ -110,7 +108,7 @@ export default class CSI extends IndexFile {
       // the binning index
       const binCount = bytes.readInt32LE(curr)
       curr += 4
-      const binIndex: { [key: string]: Chunk[] } = {}
+      const binIndex: Record<string, Chunk[]> = {}
       let stats // < provided by parsing a pseudo-bin, if present
       for (let j = 0; j < binCount; j++) {
         const bin = bytes.readUInt32LE(curr)

src/htsget.ts

@@ -18,7 +18,7 @@ async function concat(arr: HtsgetChunk[], opts?: Record<string, any>) {
       } else {
         //remove referer header, it is not even allowed to be specified
         // @ts-expect-error
-        //eslint-disable-next-line @typescript-eslint/no-unused-vars
+
         const { referer, ...rest } = headers
         const res = await fetch(url, {
           ...opts,

src/record.ts

@@ -7,7 +7,7 @@ const CIGAR_DECODER = 'MIDNSHP=X???????'.split('')
  * Class of each BAM record returned by this API.
  */
 export default class BamRecord {
-  private data = {} as { [key: string]: any }
+  private data = {} as Record<string, any>
   private bytes: { start: number; end: number; byteArray: Buffer }
   private _id: number
   private _tagOffset: number | undefined
@@ -83,12 +83,12 @@ export default class BamRecord {
     tags = tags.concat(this._tagList || [])
 
     for (const k of Object.keys(this.data)) {
-      if (k[0] !== '_' && k !== 'next_seq_id') {
+      if (!k.startsWith('_') && k !== 'next_seq_id') {
         tags.push(k)
       }
     }
 
-    const seen: { [key: string]: boolean } = {}
+    const seen: Record<string, boolean> = {}
     return tags.filter(t => {
       if (
         (t in this.data && this.data[t] === undefined) ||
@@ -493,8 +493,6 @@ export default class BamRecord {
     }
   }
 
-  _flags() {}
-
   length_on_ref() {
     if (this.data.length_on_ref) {
       return this.data.length_on_ref
@@ -605,9 +603,9 @@ export default class BamRecord {
   }
 
   toJSON() {
-    const data: { [key: string]: any } = {}
+    const data: Record<string, any> = {}
     for (const k of Object.keys(this)) {
-      if (k.charAt(0) === '_' || k === 'bytes') {
+      if (k.startsWith('_') || k === 'bytes') {
         continue
       }
       //@ts-ignore

src/util.ts

@@ -75,7 +75,7 @@ export interface BaseOpts {
 }
 
 export function makeOpts(obj: AbortSignal | BaseOpts = {}): BaseOpts {
-  return 'aborted' in obj ? ({ signal: obj } as BaseOpts) : (obj as BaseOpts)
+  return 'aborted' in obj ? ({ signal: obj } as BaseOpts) : obj
 }
 
 export function optimizeChunks(chunks: Chunk[], lowest?: VirtualOffset) {
@@ -140,7 +140,7 @@ export function parseNameBytes(
   let currRefId = 0
   let currNameStart = 0
   const refIdToName = []
-  const refNameToId: { [key: string]: number } = {}
+  const refNameToId: Record<string, number> = {}
   for (let i = 0; i < namesBytes.length; i += 1) {
     if (!namesBytes[i]) {
       if (currNameStart < i) {

test/bai.test.ts

@@ -190,8 +190,8 @@ test('read as pairs', async () => {
   expect(features.map(f => f.get('name')).sort()).toEqual(
     features2.map(f => f.get('name')).sort(),
   )
-  const f = features[features.length - 1]
-  const f2 = features2[features2.length - 1]
+  const f = features.at(-1)
+  const f2 = features2.at(-1)
   expect(f.get('start')).toEqual(f2.get('start'))
 })
 

test/vanilla-node.test.ts

@@ -13,7 +13,7 @@ describe('using vanilla node filehandles', () => {
     expect(indexData.bai).toEqual(true)
     expect(await ti.lineCount(0)).toEqual(9596)
     expect(await ti.hasRefSeq(0)).toEqual(true)
-    filehandle.close()
+    await filehandle.close()
   })
 
   it('gets features from volvox-sorted.bam', async () => {
@@ -39,7 +39,7 @@ describe('using vanilla node filehandles', () => {
     expect(records[0].getReadBases()).toEqual(
       'TTGTTGCGGAGTTGAACAACGGCATTAGGAACACTTCCGTCTCTCACTTTTATACGATTATGATTGGTTCTTTAGCCTTGGTTTAGATTGGTAGTAGTAG',
     )
-    bam.close()
-    bai.close()
+    await bam.close()
+    await bai.close()
   })
 })