nwunsch

Needleman–Wunsch algorithm implementation in Lua.

Features

• Sequence Comparison: The package enables the comparison of two sequences (seq1 and seq2) by considering all possible alignments and choosing the best one.

• Scoring System: The scoring system is customisable with match, mismatch, and gap parameters, allowing users to define the reward for matched characters and penalties for mismatches and gaps.

• Matrix Generation and Population: It creates a dynamic programming matrix of sequence lengths and populates it accordingly based on optimal alignment values.

• Traceback Functionality: It includes a traceback procedure which identifies the optimal path through the matrix, producing the final alignment of the input sequences.

• Efficient Evaluation: It utilises a max function to determine the maximum score between match, mismatch, and gap; this feature guarantees the efficiency of the sequence alignment process.

Installation

Install the nwunsch package in your Lua project by installing it with the following command:

luarocks install nwunsch

Usage

local nwunsch = require("nwunsch")

-- Use the package functions
local seq1 = "AGACTAGTTACCGTAGGCTCGAGTCGGATCGGATCGGATCGGATCAA"
local seq2 = "CGAGACGTGACCTTAGGCTCGAGTCGGATCGGATCGGATCGGA"
local match = 2
local mismatch = -1
local gap = -2

local score, align1, align2 = nwunsch.NeedlemanWunsch(seq1, seq2, match, mismatch, gap)
print("Alignment score:", score)
print("Alignment 1:", align1)
print("Alignment 2:", align2)

Use Case: Execute the gene.lua sample code in the examples directory.

License

This project is licensed under the MIT License.

Copyright

(c) 2024 Finbarrs Oketunji.

📚📚 Go and purchase a Lua book.